files from another job e.g., 614e0a1b
The raw output files for each step of the pipeline can be found here and downloaded as a ZIP file here.
The output are files with "_swap.pdb".
Load the demo and change the beginning of the chain A into chain C, with "A>B":
# yC_5lj3_Exon_Intron_rpr >A:1-16 UAAGUGAUCUAGAAAG >B:1-33 GUAUGUCUAAAUGCUCUUAUUUACUAACAAAAU # yC_5lj3_Exon_Intron_rpr_swap >B:1-16 UAAGUGAUCUAGAAAG >A:1-33
We are exploring using https://piwik.pro to track usage of the server for grant proposals, scientific presentations. Please write to us if there is any problem with your job mail us [behind Apple Hide My Mail]. You can also write an empty mail to sign to our Google Group to ask questions and shape the tools! Join our Google Group or write an empty e-mail to rna-tools+subscribe@googlegroups.com.