rna-tools.online


rna-tools.online

Swap chains in PDB files

files from another job e.g., 614e0a1b

Example: A>B

The raw output files for each step of the pipeline can be found here and downloaded as a ZIP file here.

Documentation

The output are files with "_swap.pdb".

Load the demo and change the beginning of the chain A into chain C, with "A>B":

# yC_5lj3_Exon_Intron_rpr
>A:1-16
UAAGUGAUCUAGAAAG
>B:1-33
GUAUGUCUAAAUGCUCUUAUUUACUAACAAAAU
# yC_5lj3_Exon_Intron_rpr_swap
>B:1-16
UAAGUGAUCUAGAAAG
>A:1-33


We are exploring using https://piwik.pro to track usage of the server for grant proposals, scientific presentations.
Please write to us if there is any problem with your job mail us [behind Apple Hide My Mail].
You can also write an empty mail to sign to our Google Group to ask questions and shape the tools! Join our Google Group or write an empty e-mail to rna-tools+subscribe@googlegroups.com.